Type a gene ID:

Select stage: Select cultivar:


Number of variants: 20

GENESTAGECULTIVARCHROMPOSITIONREFERENCEALTERNATIVEANNOTATIONLOF?
Phvul.001G002000
ANT30
PHA1037
chr01
139858
A
G
synonymous_variant
NO
Phvul.001G008400
ANT30
PHA1037
chr01
624218
A
G
synonymous_variant
NO
Phvul.001G008600
ANT30
PHA1037
chr01
635706
G
T
synonymous_variant
NO
Phvul.001G008900
ANT30
PHA1037
chr01
657210
CAATAATAATAATAATAATA
CAATAATAATAATAATAATA
3_prime_UTR_variant
NO
Phvul.001G009100
ANT30
PHA1037
chr01
671419
A
T
upstream_gene_variant
NO
Phvul.001G009100
ANT30
PHA1037
chr01
671991
A
G
upstream_gene_variant
NO
Phvul.001G011100
ANT30
PHA1037
chr01
865320
A
G
missense_variant
NO
Phvul.001G011100
ANT30
PHA1037
chr01
865784
C
G
3_prime_UTR_variant
NO
Phvul.001G012100
ANT30
PHA1037
chr01
926941
GATATATATATATATATATA
GATATATATATATATATATA
3_prime_UTR_variant
NO
Phvul.001G012900
ANT30
PHA1037
chr01
981456
C
G
missense_variant
NO
Phvul.001G013300
ANT30
PHA1037
chr01
1009793
C
CCAGT
upstream_gene_variant
NO
Phvul.001G017300
ANT30
PHA1037
chr01
1343807
G
A
synonymous_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362034
T
C
3_prime_UTR_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362037
C
A
3_prime_UTR_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362060
T
C
3_prime_UTR_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362067
C
T
3_prime_UTR_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362084
A
C
3_prime_UTR_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362109
A
C
3_prime_UTR_variant
NO
Phvul.001G017500
ANT30
PHA1037
chr01
1362115
A
T
3_prime_UTR_variant
NO
Phvul.001G017600
ANT30
PHA1037
chr01
1363948
A
G
synonymous_variant
NO